Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATAGTTTCTCTTGTTCTGCAC
Class I knotted-like homeodomain protein that is required for shoot apical meristem (SAM) formation during embryogenesis and for SAM function throughout the lifetime of the plant. Functions by preventing incorporation of cells in the meristem center into differentiating organ primordia.
Computational Description
SHOOT MERISTEMLESS (STM); CONTAINS InterPro DOMAIN/s: KNOX2 (InterPro:IPR005541), ELK (InterPro:IPR005539), Homeobox (InterPro:IPR001356), Homeobox, conserved site (InterPro:IPR017970), KNOX1 (InterPro:IPR005540), Homeodomain-like (InterPro:IPR009057), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: KNOTTED-like from Arabidopsis thaliana (TAIR:AT4G08150.1); Has 6066 Blast hits to 6064 proteins in 384 species: Archae - 0; Bacteria - 0; Metazoa - 1706; Fungi - 298; Plants - 3900; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink).