Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUAAGUCUUCUAUUGAUGUU
Sulfite exporter TauE/SafE family protein; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF81 (InterPro:IPR002781); BEST Arabidopsis thaliana protein match is: Sulfite exporter TauE/SafE family protein (TAIR:AT1G11540.1); Has 2571 Blast hits to 2364 proteins in 652 species: Archae - 89; Bacteria - 1424; Metazoa - 0; Fungi - 0; Plants - 205; Viruses - 0; Other Eukaryotes - 853 (source: NCBI BLink).