Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCGUUGUCUGUUCGACCUU
Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the proposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown.
Computational Description
FORMS APLOID AND BINUCLEATE CELLS 1C (FAB1C); FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity, ATP binding; INVOLVED IN: phosphatidylinositol metabolic process, cellular protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT3G14270.1); Has 4961 Blast hits to 4644 proteins in 430 species: Archae - 584; Bacteria - 4; Metazoa - 1658; Fungi - 1043; Plants - 685; Viruses - 0; Other Eukaryotes - 987 (source: NCBI BLink).
A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
Computational Description
exocyst subunit exo70 family protein H4 (EXO70H4); INVOLVED IN: exocytosis, vesicle docking involved in exocytosis; LOCATED IN: exocyst; EXPRESSED IN: stem, sperm cell, stamen, pollen tube; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Exo70 exocyst complex subunit (InterPro:IPR004140); BEST Arabidopsis thaliana protein match is: exocyst subunit exo70 family protein H3 (TAIR:AT3G09530.1); Has 837 Blast hits to 827 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 71; Plants - 622; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).