SAUR-like auxin-responsive protein family ; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: SAUR-like auxin-responsive protein family (TAIR:AT2G46690.1); Has 1421 Blast hits to 1407 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1420; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC